Sequence Search Tool
Use Amplicon Express' Sequence Search Tool to look for the occurrence of a specific
sequence such as poly-T tails, repeats, or other sequences of interest inside any number of FASTA-formatted sequence reads. Simply cut and paste the FASTA-formatted sequence
you would like to search on in the area below, enter the sequence you would like to search for, and press
the 'Search for Sub-sequence' button.
Results will be displayed in a printer-friendly format.
Great Uses for this Tool:
- Use the search string A,G,C,T to colorize your sequence and count the number of each base present
- Enter bases immediately to the 5' and 3' side of your insert cut site to find the insert sequence in your vector
- Find multiple sub-sequences in multiple fasta-formatted sequences, such as polyA tails, microsat repeats, etc.
- Search both sequence strands for your query.
- Flip your sequence from 5' -> 3' to 3' -> 5'
Don't forget:
- FASTA headers must not contain spaces if you are going to BLAST the sequences
- You may want to trim vector before running this analysis
- Only 'agctAGCTxXnN' are allowed in sequence data (header lines are excluded from this rule)
- You can view the complement of your sequence and perform a search on that as well.
Other Resources
Request An Online Quote | Visit Our Online Store
Other Tools: Sequence Finder |
Protein Translation Tool |
Oligo Tm Calculator |
Phred Quality Score Analyzer | Vector Trimming Tool
Sample Data
- Cut and paste the sample data to see what your results will look like
>PGEM.M13F
CTAGAGTCGACCTGCAGGCATGCAAGCTTGAGTATTCTATAGTGT
CACCTAAATAGCTTGGCGTAATCATGGTCATAGCTGTTTCCTGTG
TGAAATTGTTATCCGCTCACAATTCCACACAACATACGAGCCGGA
AGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGCTAACTC
ACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCGGGAAAC
Search String: TGCAG,AAA
|
|
|
|
View the complement of your sequence by checking the 'Sequence Complement' button or reverse your sequence, ie 'flip it' by choosing
'Invert Sequence' and pressing 'Make Change'
You can then search for a specified sequence on the complement sequence.
Invert Sequence Complement
|
|
|
Enter Multiple Search Sequences, separated by commas:
|