Support | Contact | Online Store
Home | Custom DNA Libraries | Pre-made Libraries | DNA Sequencing | Other Biological Services | Request A Quote | Corporate | Technical Support |

Amplicon Express
2345 NE Hopkins Ct.
Pullman, WA 99163

1-509-332-8080 (Local)
1-877-332-8080 (Toll-free)

Protein Analysis Tool

Amplicon Express' free protein analysis tool can be used to identify the protein sequence of a given nucleic acid sequence in the first, second, third, or all three frames. Protein sequences generated through this tool can be sent directly to NCBI's protein-protein BLAST query for fast analysis; simply click on the links below your result to do so.

    Remember:
  • Protein-protein BLAST will only accept one sequence at a time; thus even if your translation generates multiple results and is sent to the BLAST servers, only the result for the first protein sequence returned here will be able to be queried at one time.
  • Multiple sequences can be translated in all 3 frames with this tool
  • Sequences must be in a FASTA format, as shown below
  • The letters 'unk' in a protein sequence indicate that the program could not identify the amino acid corresponding to your nucleotide sequence. Usually you'll see 'unk' at the end of a sequence where only two bases are left; the 'unk' will be truncated if you send your sequence to the BLAST servers.


Other Resources
Request An Online Quote | Visit Our Online Store


Other Tools:
Sequence Finder |  Protein Translation Tool |  Oligo Tm Calculator | 
Phred Quality Score Analyzer | Vector Trimming Tool

Example Sequence:(Copy and Paste into the window below an press 'Generate My Protein')

>pGEM.M13F ABI
CGAATTCGAGCTCGGTACCCGGGGATCCTCTAGAGTC TCTATAGTGTCACCTAAATAGCTTGGCGTAATCATGG CGCTCACAATTCCACACAACATACGAGCCGGAAGCAT AGCTAACTCACATTAATTGCGTTGCGCTCACTGCCCG GCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGT TCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCG CGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGA GAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCAT ATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGG
AAGCTCCCTCGT


Invert your sequence 3'->5' by choosing 'Invert Sequence' and pressing 'Make Change' You can then translate your protein from the reversed sequence.
Invert Sequence  

Choose A Translation Frame: 1st Frame: |  2nd Frame: |  3rd Frame: |  All Frames:

Paste Your Fasta-formatted sequence here:


Protein BLAST My Results
Banner design by Joel Sturgill · Layout & Scripting by Jerry Higbee · Copyright © 2006 Amplicon Express, Inc. All rights reserved.
Home |  Custom DNA Libraries |  Pre-made Libraries |  DNA Sequencing |  Other Biological Services |  Request A Quote |  Corporate |  Technical Support